Blastocrithidia nuclear code
≈ 1 min read
Names in other languages
No names in other languages are held for this entry yet.
Article bodies are English and are not machine-translated. A name in another language is not a translation of the article.
The Blastocrithidia nuclear code (translation table 31) is a genetic code used by the nuclear genome of the trypanosomatid genus Blastocrithidia. This code, along with translation tables 27 and 28, is remarkable in that every one of the 64 possible codons can be a sense codon.
The Blastocrithidia nuclear code (translation table 31) is a genetic code used by the nuclear genome of the trypanosomatid genus Blastocrithidia. This code, along with translation tables 27 and 28, is remarkable in that every one of the 64 possible codons can be a sense codon. ==The code (31)== AAs = FFLLSSSSYYEECCWWLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG Starts = ----------**-----------------------M---------------------------- Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U). Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Val, V). ==Differences from the standard code== ==See also== List of all genetic codes: translation tables 1 to 16, and 21 to 33. The genetic codes database. ==References==
Text derived from https://en.wikipedia.org/w/index.php?oldid=1302315858 under CC BY-SA 4.0; modifications have been made.