Stemloc

In bioinformatics, Stemloc is an open source software for multiple RNA sequence alignment and RNA structure prediction based on probabilistic models of RNA structure known as Pair stochastic context-free grammars (also probabilistic context-free grammars). Stemloc attempts to simultaneously predict and align the structure of RNA sequences with an improved time and space cost compared to previous methods with the same motive. The resulting software implements constrained versions of the Sankoff algorithm by introducing both fold and alignment constraints, which reduces processor and memory usage and allows for larger RNA sequences to be analyzed on commodity hardware. Stemloc was written in 2004 by Ian Holmes. Stemloc can be downloaded as part of the DART software package. It accepts input files in either FASTA or Stockholm format.

In bioinformatics, Stemloc is an open source software for multiple RNA sequence alignment and RNA structure prediction based on probabilistic models of RNA structure known as Pair stochastic context-free grammars (also probabilistic context-free grammars). Stemloc attempts to simultaneously predict and align the structure of RNA sequences with an improved time and space cost compared to previous methods with the same motive. The resulting software implements constrained versions of the Sankoff algorithm by introducing both fold and alignment constraints, which reduces processor and memory usage and allows for larger RNA sequences to be analyzed on commodity hardware. Stemloc was written in 2004 by Ian Holmes. Stemloc can be downloaded as part of the DART software package. It accepts input files in either FASTA or Stockholm format. Input in Stemloc can either be in FASTA or Stockholm format (see above for descriptions of each). Sample input shown below: stemloc --local dynalign.trna The "--local" command analyzes the file in local alignment mode. Using "--global" will use global alignment mode. This output is in Stockholm format. It shows the sequence names, the co-ordinates of the matches, the alignment, the consensus primary sequence, the secondary structure of each sequence, the consensus secondary structure, and the log-odds score of the alignment in bits. The "//" line is used to separate alignments or indicate end of file. Sample output shown below: STOCKHOLM 1.0 =GR RD0260/26-67 SS .. >>>>.....( >>>). RD0260/26-67 UACUCCCCUGUCACGGGAGAGAAUGUGGGUUCAAAUCCCAUC =GC PS_cons UAC..CCCUGUCACGG..G.GA..G.GGGUUC.AAUCCC..C RD0500/26-66 UACGACCCUGUCACGGUCGUGA-CGCGGGUUCgAAUCCCGCC =GR RD0500/26-66 SS .. >>>>...-. >>>>. =GC SS_cons .. >>>>..... >>>>. =GF SC 31.872 // Stemloc relies heavily on stochastic context-free grammars, which can be seen as a scoring scheme for the algorithm. Because Sankoff's algorithm considers all possible folds and all possible alignments it is quite accurate and thorough, but it takes a measurable amount of time to obtain any results or output. To better this, Stemloc allows the user to constrain the total number of folds and alignments to be considered. More specifically, each sequence can be pre-folded individually in O(L^3) time and pre-aligned, ignoring secondary structure in O(L^2) time. For example, the using the "-fast" command below will only consider the 100 best RNA structures rather than analyzing all possible folds. Using the "-log DOTPLOT" command will output a visual representation of the fold and alignment envelopes. stemloc nanos-tiny.rna -fast -log DOTPLOT The main idea of Stemloc is being able to set a threshold for the number of folds and alignments that are sampled to create the envelopes. This can be done with the options "-nf" and "-na", which sets the number of folds and alignments to be considered. (Using a -1 will unlimited the number of folds and alignments sampled, thus using -1 for both parameters will run the Sankoff algorithm on the input dataset. stemloc nanos-tiny.rna -nf -1 -na -1

Text derived from https://en.wikipedia.org/w/index.php?oldid=1303518325 under CC BY-SA 4.0; modifications have been made.